View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7710_high_15 (Length: 381)
Name: NF7710_high_15
Description: NF7710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7710_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 178 - 259
Target Start/End: Complemental strand, 44311066 - 44310985
Alignment:
| Q |
178 |
aatcaatggtgacaaaagttgtttaaaagattagtgttaatggcaatgaatatgatttccctttaattcttgactgagtatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44311066 |
aatcaatggtgacaaaagttgtttaaaagattagtgttaatggcaatgaatatgatttccctttaattcttgactgagtatt |
44310985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 279 - 350
Target Start/End: Complemental strand, 44310942 - 44310871
Alignment:
| Q |
279 |
tgttccaactctgcatcacctgcacatctttgacaacaaaagttatggttcttatgccaacatattatttct |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310942 |
tgttccaactctgcatcacctgcacatctttgacaacaaaagttatggttcttatgccaacatattatttct |
44310871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 44311230 - 44311174
Alignment:
| Q |
19 |
agatttacatcacaatatgttaattgaatgacaacttcctcaaaccagatgcatcta |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44311230 |
agatttacatcacaatatgttaattgaatgacaacttcctcaaaccagatgcatcta |
44311174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University