View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7710_high_21 (Length: 301)
Name: NF7710_high_21
Description: NF7710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7710_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 22361773 - 22362040
Alignment:
| Q |
18 |
caccaggagcagcccatgttgaaggaagtattacagcttcgcgttgagcatcgacgacgtccttcatagtgccctcactcacaccaaatgcagctgcaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361773 |
caccaggagcagcccatgttgaaggaagtattacagcttcacgttgagcatcgacgacgtccttcatagtgccctcactcacaccaaatgcagctgcaag |
22361872 |
T |
 |
| Q |
118 |
ttcaggtcccaaaatggtcttaagaagtgatgcagcacctgctagaaactgtggatggctcttttttgatgaggttgtgaatccaaagaactctaagggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361873 |
ttcaggtcccaaaatggtcttaagaagtgatgcagcacctgctagaaactgtggatagctcttttttgatgaggttgtgaatccaaagaactctaagggt |
22361972 |
T |
 |
| Q |
218 |
ccatttcttgcagctatttgacagaaaggaaagtatcttggtatgtagaatatgtctcctactttgat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361973 |
ccatttcttgcagctatttgacagaaaggaaagtatcttggtatgtagaatatgtctcctactttgat |
22362040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University