View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7710_high_8 (Length: 464)

Name: NF7710_high_8
Description: NF7710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7710_high_8
NF7710_high_8
[»] chr1 (1 HSPs)
chr1 (408-448)||(44322658-44322698)


Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 408 - 448
Target Start/End: Complemental strand, 44322698 - 44322658
Alignment:
408 agaaacatcagataccaacgtttcattttcgaacttgatag 448  Q
    |||||||||||||||||||||||||||||||||||||||||    
44322698 agaaacatcagataccaacgtttcattttcgaacttgatag 44322658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University