View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7710_low_37 (Length: 353)
Name: NF7710_low_37
Description: NF7710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7710_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 230 - 334
Target Start/End: Original strand, 20824403 - 20824508
Alignment:
| Q |
230 |
ttgcaaaagtatcaattttaccccta-ttaaaataaaacatcaatgcaacttcttaactttacccccttttttaagtgtcaaattttgatccgaccaacg |
328 |
Q |
| |
|
||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
20824403 |
ttgcaaaagtatcgattttacccccaattaaaataaaacatcaatgcaacttcttaactttacccccttttttaagtgccaaattttgatctgaccaacg |
20824502 |
T |
|
| Q |
329 |
cttgtg |
334 |
Q |
| |
|
|||||| |
|
|
| T |
20824503 |
cttgtg |
20824508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 20824261 - 20824317
Alignment:
| Q |
1 |
attatttatttattttttagaggccaaaatgccacataatttacaatttatcggaat |
57 |
Q |
| |
|
||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20824261 |
attattttttttttttttaaaggccaaaatgccacataatttacaatttatcggaat |
20824317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University