View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7710_low_43 (Length: 321)
Name: NF7710_low_43
Description: NF7710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7710_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 33 - 304
Target Start/End: Complemental strand, 25691420 - 25691149
Alignment:
| Q |
33 |
agggatggttagtacttgtagttgtttacttgtttgattataatgtgaatgcaaaaaataagatgagatagcattgaagagatattaagacctgcatgaa |
132 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25691420 |
agggatggttattacttgtagctgtttacttgcttgattataatgtgaatgcaaaaaataagatgagatagcattgaagagatattaagacctgcatgaa |
25691321 |
T |
 |
| Q |
133 |
gacattgatcatgttggtatggcaagacttgatgatgatgcgtaggataaggagcatgcgcagaatagaaccctctggaccaccctacaccattaacaac |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25691320 |
gacattgatcatgttggtatggcaagacttgatgatgatgcgtaggataaggaacatgcgcagaatagaaccctctggaccaccctacaccattaacaac |
25691221 |
T |
 |
| Q |
233 |
ctcattcttaccattcccatcactacccttaccatgatgtcccactcctctgctaacataagccgactgatc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25691220 |
ctcattcttaccattcccatcactacccttaccatgatgtcccactcctctgctaacataagccgactgatc |
25691149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University