View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7710_low_59 (Length: 243)
Name: NF7710_low_59
Description: NF7710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7710_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 120 - 227
Target Start/End: Complemental strand, 53086038 - 53085930
Alignment:
| Q |
120 |
ccacctaactaactcagctcgcctcgttccgttttgaatggatttagatggtacggacctatacagaggga-cccccgcttttccatccctatgtattta |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||| ||||| ||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
53086038 |
ccacctaactaactcagctcgcctcattccgttttgagcggatttagacggtacagacctatacagagagaccccccgcttttccatccctatgtattta |
53085939 |
T |
|
| Q |
219 |
tatgtgtgt |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
53085938 |
tatgtgtgt |
53085930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University