View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7710_low_59 (Length: 243)

Name: NF7710_low_59
Description: NF7710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7710_low_59
NF7710_low_59
[»] chr4 (1 HSPs)
chr4 (120-227)||(53085930-53086038)


Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 120 - 227
Target Start/End: Complemental strand, 53086038 - 53085930
Alignment:
120 ccacctaactaactcagctcgcctcgttccgttttgaatggatttagatggtacggacctatacagaggga-cccccgcttttccatccctatgtattta 218  Q
    ||||||||||||||||||||||||| |||||||||||  ||||||||| ||||| ||||||||||||| || ||||||||||||||||||||||||||||    
53086038 ccacctaactaactcagctcgcctcattccgttttgagcggatttagacggtacagacctatacagagagaccccccgcttttccatccctatgtattta 53085939  T
219 tatgtgtgt 227  Q
    |||||||||    
53085938 tatgtgtgt 53085930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University