View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_high_13 (Length: 303)
Name: NF7711_high_13
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 45459428 - 45459137
Alignment:
| Q |
1 |
gtcgaggatgacgtggatgcttaacaccttcttgatcacatccattggttttcctgagataggtgccatcccactgttatcgactgcaagaactgttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459428 |
gtcgaggatgacgtggatgcttaacaccttcttgatcacatccattggttttcctgagataggtgccatcccactgttatcgactgcaagaactgttatc |
45459329 |
T |
 |
| Q |
101 |
gtttgtctcgagtttatttcggttgctagttgggtttgggtgaggtagttgctgtaactgctgtatgcagggtactgggacaatatttttgttatgtcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459328 |
gtttgtctcgagtttatttcggttgctagttgggtttgggtgaggtagttgctgtaactgctgtatgcagggtactgggacaatatttttgttatgtcaa |
45459229 |
T |
 |
| Q |
201 |
aacaggttatagataagggaaacaacattattattagtaaaattaagaacatcattgtcaatgaagaacatgacacacacattttgaatatt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459228 |
aacaggttatagataagggaaacaacattattattagtaaaattaagaacatcattgtcaatgaagaacatgacacacacattttgaatatt |
45459137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University