View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_27 (Length: 385)
Name: NF7711_low_27
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 25 - 375
Target Start/End: Original strand, 36715701 - 36716051
Alignment:
| Q |
25 |
gttcatactatgccggaagcacgagaccgccgcgtcattcctcttgacgtggatactctattccgacgacctttctccgccgtgtttcaagaatctgagc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36715701 |
gttcatactatgccggaagcacgagaccgccgcgtcattcctcttgacgtggatactctattccgacgacctttctccgccgtgtttcaagaatctgagc |
36715800 |
T |
 |
| Q |
125 |
cactctccgttacacccgcacctgctccattcaccgccggttcagatcggttcttcactgaaagaactcccgtacgtcgcgaagttgctcgtgcgcgtcg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36715801 |
cactctccgttacacccgcacctgctccattcaccgccggtttagatctgttcttcactgaaagaactcccgtacgtcgcgaagttgctcgtgcgcgtcg |
36715900 |
T |
 |
| Q |
225 |
ttctccaggttcggaaaatactcctccgaccactgctcgccgtggaagaggccgtgctactgcatcgaggagtgtacttccgtcttggtacccgaggacg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36715901 |
ttctccaggttcggaaaatactcctccgaccactgctcgccgtggaagaggccgtgctactgcatcgaggagtgcacttccgtcttggtacccgaggacg |
36716000 |
T |
 |
| Q |
325 |
ccgttgcaggatatcactgctattgttcgagtaaatctctatctctctctg |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716001 |
ccgttgcaggatatcactgctattgttcgagtaaatctctatctctctctg |
36716051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University