View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_32 (Length: 367)
Name: NF7711_low_32
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 355
Target Start/End: Original strand, 30128482 - 30128837
Alignment:
| Q |
1 |
cttgttttgtggccttcacggggttctggtttcggctacaacatgctgtgtttgtctgttttgcttactatgggtttcgggnnnnnnnnnnnn-gtatcg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30128482 |
cttgttttgtggccttcacggggttctggtttcggctacaacatgctgtgtttgtctgttttgcttactatgggtttcgggttgttttttttttgtatcg |
30128581 |
T |
|
| Q |
100 |
atgttttgccagtttcagcatcccagtagtggttgttttttgctgtgtttctcttcgggtattccgtctatataccacatccgatgttttgtatttccct |
199 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30128582 |
atgttttggtagtttcagcatcctagtagtggttgttttttgctgtgtttctcttcgggtattccgtctatataccacatccgatgttttgtatttccct |
30128681 |
T |
|
| Q |
200 |
gtgtggcaagattggtgcatctcgtgcaggttttgcttttcaatatactttgctgatagcaaaaatgaatgtgaaatttatgcaaataatataacttgtt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30128682 |
gtgtggcaagattggtgcatctcgtgcaggttttgcttttcaatatactttgctgatagcaaaaatgaatgtgaaatttatgcaaataatataatttgtt |
30128781 |
T |
|
| Q |
300 |
ctgcattaagcttttagtaaataagtggctgcattgcataagcattaaattgtgat |
355 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
30128782 |
ctgcattaagcttttagtaaataagtggatacattgcataagcattaaattgtgat |
30128837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University