View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_35 (Length: 346)
Name: NF7711_low_35
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 17 - 330
Target Start/End: Complemental strand, 43801535 - 43801219
Alignment:
| Q |
17 |
catatgtagtacttacatggttgtctattttttgcttgagatagtactatagtagttctggtcagattatagagtagaaagccagggttcctttttatag |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43801535 |
catatgtagtacttacatggttgcctattttttgcttgagatagtactatagtagttctggtcagattatagagtagaaagccagggttcctttttatag |
43801436 |
T |
|
| Q |
117 |
gggataattatttgctttacattggtgacttgctgatatatttagtgggtcgacttactggtttattagggtgttatgctttaatagggcataagttact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
43801435 |
gggataattatttgctttacattggtgacttgctgatatatttagtgggtcgacttactggttttttggggtgttatgctttaatagggcataagttact |
43801336 |
T |
|
| Q |
217 |
gaatgtgggtaaag---ggacatgcttgcattgcaaatactagaatctagtttcagggttctgttgaattttgtgttgtgaaattaggattttgggattt |
313 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43801335 |
gaatgtgggtaaaggcaggacatgcttgcattgcaaacactagaatctagtttcagggttctgttgagttttgtgttgtgaaattaggattttgggattt |
43801236 |
T |
|
| Q |
314 |
gtgggttttgggaagga |
330 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43801235 |
gtgggttttgggaagga |
43801219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University