View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_37 (Length: 329)
Name: NF7711_low_37
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 23272654 - 23272824
Alignment:
| Q |
18 |
atcatgatggttaagagtgtaagggtaataaaatggttcacaaaatattggtaaaaaagtttaacatacttgtgttttgatgagtttgaggaatttggca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23272654 |
atcatgatggttaagagtgtaagggtaataaaatggttcacaaaatattggtaaaaaagtttaacatacttgtgttttgatgagtttgaggaatttggca |
23272753 |
T |
|
| Q |
118 |
acattgaaggcattttagttagcacttcgatgaaaacaagaaaggtacaaaggtaatgatgttgtggggtg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23272754 |
acattgaaggcattttagttagcacttcgatgaaaacaagaaaggtacaaaggtaatgatgttgtggggtg |
23272824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 253 - 316
Target Start/End: Original strand, 23272889 - 23272952
Alignment:
| Q |
253 |
tggttttaaagagcatggagggacctatgaaatgaagggggcagatgaagggattaaatgatga |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23272889 |
tggttttaaagagcatggagggacctatgaaatgaagggggcagatgaagggattaaatgatga |
23272952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University