View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_49 (Length: 253)
Name: NF7711_low_49
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 45031571 - 45031351
Alignment:
| Q |
20 |
gtgtatgcgtttcactccagttgcatggatcatctctctcagtcaatgcttggtatgcccggtaaaactaatcaacaagtttcacaagctccagatgctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45031571 |
gtgtatgcgtttcactccagttgcatggatcatctctctcagtcaatgcttggtatgcccggtaaaactaatcaacaagtttcacaagctccagatgctt |
45031472 |
T |
|
| Q |
120 |
cttgtaatacattgctgccattctggtaaaggaatcatcatcttctttgagaagctttaacatttgcttcatttcttttaaaggatggttcannnnnnnn |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45031471 |
cttgtaatacattgctgccattctggtaaaggaatccacatcttctttgagaagctttaacatttgcttcatttcttttaaaggatggttcatttttttt |
45031372 |
T |
|
| Q |
220 |
naaggatcatttgcttcatct |
240 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45031371 |
taaggatcatttgcttcatct |
45031351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 31 - 155
Target Start/End: Complemental strand, 38204863 - 38204740
Alignment:
| Q |
31 |
tcactccagttgcatggatcatctctctcagtcaatgcttggtatgcccggtaaaactaatcaacaagtttcacaagctccagatgcttcttgtaataca |
130 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||| |||||||||||||||||| ||||| | ||||| |||||| || ||||||||||||||| |
|
|
| T |
38204863 |
tcactccagttgcatg-atcatatctctcagccaatgctcggtatgcccggtaaaactcttcaaccaatttcataagctctggacgcttcttgtaataca |
38204765 |
T |
|
| Q |
131 |
ttgctgccattctggtaaaggaatc |
155 |
Q |
| |
|
|| ||||| |||||| ||||||||| |
|
|
| T |
38204764 |
tttctgcccttctggcaaaggaatc |
38204740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University