View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_50 (Length: 250)
Name: NF7711_low_50
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 26 - 237
Target Start/End: Complemental strand, 12834719 - 12834507
Alignment:
| Q |
26 |
gtaacatttagaaggactaataatttatttaacccaatttaaaaaa-ccattttcatttgtcgtttgttaggccagccacttttgcataaacaagcttca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12834719 |
gtaacatttagaaggactaataatttatttaacccaattaaaaaaaaccattttcatttgtcgtttgttaggccagccatttttgcataaacaagcttca |
12834620 |
T |
 |
| Q |
125 |
gagaggtgacaatccaccacttgcatgtgtgtgcatatatatctgtgtctgtgggtataaaccaattcattgcaccgctgataccaatacggcaatacta |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12834619 |
gagaggtgacaatccaccacttgcatgtgtgtgcatatatatctgtgtctgtgggaataaaccaattcattgcaccgctgataccaatacggcaatacta |
12834520 |
T |
 |
| Q |
225 |
atactagtactct |
237 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12834519 |
atactagtactct |
12834507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University