View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7711_low_50 (Length: 250)

Name: NF7711_low_50
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7711_low_50
NF7711_low_50
[»] chr2 (1 HSPs)
chr2 (26-237)||(12834507-12834719)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 26 - 237
Target Start/End: Complemental strand, 12834719 - 12834507
Alignment:
26 gtaacatttagaaggactaataatttatttaacccaatttaaaaaa-ccattttcatttgtcgtttgttaggccagccacttttgcataaacaagcttca 124  Q
    ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||    
12834719 gtaacatttagaaggactaataatttatttaacccaattaaaaaaaaccattttcatttgtcgtttgttaggccagccatttttgcataaacaagcttca 12834620  T
125 gagaggtgacaatccaccacttgcatgtgtgtgcatatatatctgtgtctgtgggtataaaccaattcattgcaccgctgataccaatacggcaatacta 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
12834619 gagaggtgacaatccaccacttgcatgtgtgtgcatatatatctgtgtctgtgggaataaaccaattcattgcaccgctgataccaatacggcaatacta 12834520  T
225 atactagtactct 237  Q
    |||||||||||||    
12834519 atactagtactct 12834507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University