View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_54 (Length: 242)
Name: NF7711_low_54
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_54 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 49437308 - 49437531
Alignment:
| Q |
19 |
gtggaccgatgagctaaccaaggctaaaaaactattttaaaacataaggatctttcaaatggaagatcttattgagatagaattcaaagttgcatatgtg |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49437308 |
gtggaccgatgagctaaccaagggtaaaaaactattttaaaacataaagatctttcaaatggaagatcttattgagatagaattcaaagttgcatatgtg |
49437407 |
T |
|
| Q |
119 |
tagtttataaatgatcctaagactatacatgatcatcccctttgttttacctctaacaaatggataaagtcatacacaaggtcaacaaatttaattgaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49437408 |
tagtttataaatgatcctaagactatacatgatcatcccctttgttttacctctaacaaatggataaagtcatacacaaggtcaacaaatttaattgaag |
49437507 |
T |
|
| Q |
219 |
tatgataaatggattcaacaaatt |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49437508 |
tatgataaatggattcaacaaatt |
49437531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University