View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_57 (Length: 238)
Name: NF7711_low_57
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 29258752 - 29258527
Alignment:
| Q |
1 |
caaaaaattgtttttgaaaagcatctccaaatacagatgcagttaagttacatgtatgatcaatagggtgattattccaatgatggagaaagttaggatc |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29258752 |
caaaaaattgtttttcaaaagcatctccaaatacagatgcagttaagttacatgtatgatcaatagggtgactattccaatgatggagaaagttaggatc |
29258653 |
T |
 |
| Q |
101 |
ttcttattccctgcaaaatcagaaaacattatactcttgat-ttttcaaacttagaagagttgcttgcattatgatgtgctcgtgggttttgatgtgaaa |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29258652 |
ttcttattcccagcaaaatcagaaaacattatactcttgattttttcaaacttagaagagttgcttgcattatgatgtgctcgtgggttttcatgtgaaa |
29258553 |
T |
 |
| Q |
200 |
tgaccttattattgctgatatttttg |
225 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
29258552 |
tggccttattattgctgatatttttg |
29258527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University