View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7711_low_63 (Length: 227)
Name: NF7711_low_63
Description: NF7711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7711_low_63 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 49437859 - 49437633
Alignment:
| Q |
1 |
tgaagaatgcaagagttttgcaaacaatgtcaatctgtggtgttaaagctctcgaagttgaaagagaattatccttatgcccaagggtctctcctatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49437859 |
tgaagaatgcaagagttttgcaaacaatgtcaatctgtggtgttaaagctctcgaagttgaaagagaattatccttatgcccaagggtctctcctatatg |
49437760 |
T |
|
| Q |
101 |
tgaagttatactaaatgcatataggttctccccagacagttcactttaatttgcttttatgatgcagctgctaggtttgttggtttgtaatgtgaaacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49437759 |
tgaagttatactaaatgcatataggttctccccagacagttcactttaatttgcttttatgatgcagctgctaggtttgttggtttgtaatgtgaaacct |
49437660 |
T |
|
| Q |
201 |
tgattgtcattaaatttgtgttggtgc |
227 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
49437659 |
tgattgtcatgaaatttgtgttggtgc |
49437633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 60 - 109
Target Start/End: Original strand, 43362425 - 43362474
Alignment:
| Q |
60 |
gaaagagaattatccttatgcccaagggtctctcctatatgtgaagttat |
109 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
43362425 |
gaaagagaattgtccttatgtccaagggcctctcctacatgtgaagttat |
43362474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University