View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7712_high_30 (Length: 271)
Name: NF7712_high_30
Description: NF7712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7712_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 258
Target Start/End: Complemental strand, 14451625 - 14451388
Alignment:
| Q |
20 |
cgaatttcgtagcgaacaacaataaggcctgagtttaacaatgggtcaggcatttcgtcgagcatctggcagaatccgtgccgcatccgaaactgacacg |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14451625 |
cgaatttcgtagcgaacaacaataag-cctgagtttaacaatgggtcaggcatttcgtcgagcatctggcagaatccgtgccgcatccgaaactgacacg |
14451527 |
T |
 |
| Q |
120 |
tcatccttctccaagcccaagatcgccgtcgaccaccgaccacctccgccgaaggttgccactgacaaggcagcagagagctcaaagaccgtaaaaggag |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14451526 |
tcatccttgtccaagcccaagatcgccgtcgaccaccgaccaccgccgccgaaggttgccactgacaaggcagcagatagctcaaagaccgtaaaaggag |
14451427 |
T |
 |
| Q |
220 |
tagaagactcattgaacgatggttagtctctctttctct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14451426 |
tagaagactcattgaacgatggttagtctctctttctct |
14451388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University