View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7712_high_40 (Length: 229)

Name: NF7712_high_40
Description: NF7712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7712_high_40
NF7712_high_40
[»] chr3 (1 HSPs)
chr3 (15-210)||(32032273-32032468)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 32032468 - 32032273
Alignment:
15 aagaataaaataaaatcgttcaaaagggagaagaaaatagaaagggctacggttttgttctaggtgtttccataaaattgagttttgcatgcaaacactt 114  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
32032468 aagaatagaataaaatcgttcaaaagggagaagaaaatagaaagggctacggttttgttctaggtgtttccataaaattgagttttgcacgcaaacactt 32032369  T
115 tacgtaacctcataattcgccctagggacaaatccaagattagttttttggtgcagctaaattaacagtataaaaaatatgtccaattaaattaca 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
32032368 tacgtaacctcataattcgccctagggacaaatccaagattagttttttggtgcagctaaattaacggtataaaaaatatgtccaattaaattaca 32032273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University