View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7712_high_43 (Length: 205)
Name: NF7712_high_43
Description: NF7712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7712_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 17 - 121
Target Start/End: Complemental strand, 36882708 - 36882604
Alignment:
| Q |
17 |
catagaagtcaactgggaaatttgcagttaatgtcagtttcagcatttttctctgtaaatagccatcggtgcagtcctgctacaaaacatctgcacgaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36882708 |
catagaagtcaactgggaaatttgcagttaatgtcagttccagcatttttctctgtaaatagccatcggtgcagtcctgctacaaaacatctgcacgaga |
36882609 |
T |
 |
| Q |
117 |
aatac |
121 |
Q |
| |
|
||||| |
|
|
| T |
36882608 |
aatac |
36882604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University