View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7712_low_10 (Length: 429)
Name: NF7712_low_10
Description: NF7712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7712_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 4e-79; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 20 - 177
Target Start/End: Original strand, 11826404 - 11826561
Alignment:
| Q |
20 |
ggtaacatctctttttgcctcccgaaaacttgcgaagttcatactcacaaggcgtaacatttctttgattatctgtatataaataaatacattgcatttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11826404 |
ggtaacatctctttttgcctcccgaaaacttgcgaagttcatactcacaaggcgtaacatttctttgattatctgtatataaataaatacattgcatttc |
11826503 |
T |
|
| Q |
120 |
tttgatgtttttatttttaggaaatatactgaagttttaatgtaagcatatattaaca |
177 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11826504 |
tttgatgtttttatttttagaaaatatactgaagctttaatgtaagcatatattaaca |
11826561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 260 - 309
Target Start/End: Original strand, 11826584 - 11826633
Alignment:
| Q |
260 |
acttcaaagtgatgacacttcaagatctcaagccaacatcaccattgtat |
309 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11826584 |
acttcaaagtgaggacacttcaagatctcaagccaacatcaccattgtat |
11826633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 34 - 96
Target Start/End: Original strand, 11816299 - 11816361
Alignment:
| Q |
34 |
ttgcctcccgaaaacttgcgaagttcatactcacaaggcgtaacatttctttgattatctgta |
96 |
Q |
| |
|
|||||||||||||| |||||||||| || || ||||||||||||| ||| ||||||||||||| |
|
|
| T |
11816299 |
ttgcctcccgaaaaattgcgaagttgatgctgacaaggcgtaacacttcgttgattatctgta |
11816361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 34 - 102
Target Start/End: Original strand, 11802220 - 11802288
Alignment:
| Q |
34 |
ttgcctcccgaaaacttgcgaagttcatactcacaaggcgtaacatttctttgattatctgtatataaa |
102 |
Q |
| |
|
|||||||||||||| |||||| |||| || |||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
11802220 |
ttgcctcccgaaaaagtgcgaaattcaaaccgacaacacgtaacatttcgttgattacctgtatataaa |
11802288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University