View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7712_low_32 (Length: 290)
Name: NF7712_low_32
Description: NF7712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7712_low_32 |
 | |
|
| [»] scaffold0272 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0272 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 246
Target Start/End: Original strand, 6745 - 6973
Alignment:
| Q |
19 |
catacagctgtgtaacatctcccgtgtacaatttcagctgggagaagtggagaactggatgaattt-ggcagattctagaaggtgcagtttataggcaac |
117 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
6745 |
catacagctgtgtagcatctcccgtgaacaatttcagctgggagaagtggagaactggatgaattttggcagattctggaaggtgcagtttataggcaac |
6844 |
T |
|
| Q |
118 |
tgaaccaaccttcgcaataaccagaaaagacgcatactcggcttctgattatgacacaacgccactgtgtgttgtcgataaggttgaaggcgcactnnnn |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6845 |
tgaaccaaccttcgcaataaccagaaaagacgcatactcggcttctgattatgacacaacgccactgtgtgttgtcgataaggttgaaggcgcactaaaa |
6944 |
T |
|
| Q |
218 |
nnnnntcacccacctgcaactgtgcatca |
246 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6945 |
aaaaatcacccacctgcaactgtgcatca |
6973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University