View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7712_low_37 (Length: 266)
Name: NF7712_low_37
Description: NF7712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7712_low_37 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 266
Target Start/End: Complemental strand, 54088802 - 54088553
Alignment:
| Q |
17 |
gaaccatggacacacatgcatatataaggggagaattgaattacaaaatgtatattgaactaattattgagattatattgttgcttaatcatcacacagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
54088802 |
gaaccatggacacacatgcatatataaggggagaattgaattacaaaatgtatattgaactaattattgaaattatattgttgcttaatcatcacatagt |
54088703 |
T |
|
| Q |
117 |
gaaggtgaagttttattataatatggatatgattttacttaatttccacttcctgatccagcatgagatcctgcatatgaaccagcttcagagcccgctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088702 |
gaaggtgaagttttattataatatggatatgattttacttaatttccacttcctgatccagcatgagatcctgcatatgaaccagcttcagagcccgctc |
54088603 |
T |
|
| Q |
217 |
tagaagaccctgacccagcatgagaccctgcatatgaaccggcttcagaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088602 |
tagaagaccctgacccagcatgagaccctgcatatgaaccggcttcagaa |
54088553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 195 - 266
Target Start/End: Complemental strand, 54088555 - 54088484
Alignment:
| Q |
195 |
gaaccagcttcagagcccgctctagaagaccctgacccagcatgagaccctgcatatgaaccggcttcagaa |
266 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54088555 |
gaacctgcttcagaacccgctccagaagaccctgacccagcatgagaacctgcatatgaaccggcttcagaa |
54088484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 168 - 266
Target Start/End: Complemental strand, 54088525 - 54088424
Alignment:
| Q |
168 |
cctgatccagcatgagatcctgcatatgaaccagcttcagagcccgctctaga---agaccctgacccagcatgagaccctgcatatgaaccggcttcag |
264 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||| || |||| || || ||||||||| ||| |||| ||||||| || |||||||||| |
|
|
| T |
54088525 |
cctgacccagcatgagaacctgcatatgaaccggcttcagaacctgctcctgacccagcccctgaccctgcacgagatcctgcatgggagccggcttcag |
54088426 |
T |
|
| Q |
265 |
aa |
266 |
Q |
| |
|
|| |
|
|
| T |
54088425 |
aa |
54088424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University