View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7712_low_38 (Length: 255)
Name: NF7712_low_38
Description: NF7712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7712_low_38 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 88 - 255
Target Start/End: Complemental strand, 39003025 - 39002858
Alignment:
| Q |
88 |
acctactagttcacttaaaataaaatgaacataatgtttagagataaataatatatcaccctagaaggagaccgaacatgaccagtagtggaaaaagaaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39003025 |
acctactagttcacttaaaataaaatgaacataatgtttagagataaataatatatcaccctagaaggagaccgaacatgaccagtagtggaaaaagaaa |
39002926 |
T |
|
| Q |
188 |
caaacaaactcattaaccaacacaactaggcaacaaattgactaatagatagatatccatgccattct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39002925 |
caaacaaactcattaaccaacacaactaggcaacaaattgactaatagatagatatccatgccattct |
39002858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University