View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7712_low_51 (Length: 229)
Name: NF7712_low_51
Description: NF7712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7712_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 54088534 - 54088374
Alignment:
| Q |
1 |
ccagaagaccctgacccagcatgagaacctgcatatgaaccggcttcagaacctgctcctgacccagcccctgaccctgcacgagatcctgcatgggagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088534 |
ccagaagaccctgacccagcatgagaacctgcatatgaaccggcttcagaacctgctcctgacccagcccctgaccctgcacgagatcctgcatgggagc |
54088435 |
T |
|
| Q |
101 |
tggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088434 |
cggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga |
54088374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 3 - 57
Target Start/End: Complemental strand, 54088601 - 54088547
Alignment:
| Q |
3 |
agaagaccctgacccagcatgagaacctgcatatgaaccggcttcagaacctgct |
57 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54088601 |
agaagaccctgacccagcatgagaccctgcatatgaaccggcttcagaacctgct |
54088547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 123
Target Start/End: Complemental strand, 54088651 - 54088541
Alignment:
| Q |
10 |
cctgacccagcatgagaacctgcatatgaaccggcttcagaacctgctcctgacccagcccctgaccctgcacgagatcctgcatgggagctggcttcag |
109 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||| || |||| || || ||||||||| ||| |||| ||||||| || | |||||||| |
|
|
| T |
54088651 |
cctgatccagcatgagatcctgcatatgaaccagcttcagagcccgctctaga---agaccctgacccagcatgagaccctgcatatgaaccggcttcag |
54088555 |
T |
|
| Q |
110 |
aacctgctccagaa |
123 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
54088554 |
aacctgcttcagaa |
54088541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University