View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7713_low_19 (Length: 237)
Name: NF7713_low_19
Description: NF7713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7713_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 30341848 - 30341642
Alignment:
| Q |
15 |
cacgcagacatagccgggttcctacccgacgaattagccttcttatgtgatctttcacttctccacctcaatagcaaccgtttctgtggcatcattccga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30341848 |
cacgcagacatagccgggttcctacccgacgaattagccttcctatgtgatctttcacttctccacctcaatagcaaccgtttctgtggcatcattccga |
30341749 |
T |
|
| Q |
115 |
aaaccttctcaaacctaactcatctctatgagcttgaccttagtaacaacagatttgtcggaccttttcctttggtcgtgctttcccttccttcccttac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30341748 |
aaaccttctcaaacctaactcatctctatgagcttgaccttagtaacaacagatttgtcggaccttttccttcggtcgtgctttcccttccttcccttac |
30341649 |
T |
|
| Q |
215 |
ttatctc |
221 |
Q |
| |
|
||||||| |
|
|
| T |
30341648 |
ttatctc |
30341642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University