View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7714_low_1 (Length: 229)
Name: NF7714_low_1
Description: NF7714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7714_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 44852090 - 44852291
Alignment:
| Q |
1 |
ggtagacaaaatcaatcttttgagaaatcttgaatgattgcatgtaacttttgaatgatgtttcacaatcaatgggttataccaaatttgtgtggtctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44852090 |
ggtagacaaaatcaatcttttgagaaatcttgaatgattgcatgtaacttttgaatgatatttcacaatcaatgggttataccaaatttgtgtggtctaa |
44852189 |
T |
|
| Q |
101 |
gtgataaacgcctagagtcttttaaacgtctgatcagaaatttgatctttgattcttataaatataaattaaaatttatgcattgagaatacattaagaa |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44852190 |
gtgataaacgccttgagtcttttaaacgtctgatcagaaatttgatctttgattcttataaatataaattaaaatttatgcattgagaatacattaagaa |
44852289 |
T |
|
| Q |
201 |
ac |
202 |
Q |
| |
|
|| |
|
|
| T |
44852290 |
ac |
44852291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University