View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7715_high_5 (Length: 300)
Name: NF7715_high_5
Description: NF7715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7715_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 4695182 - 4695121
Alignment:
| Q |
155 |
gattaacaaggcaaatagatatcgaacgaaataag----tactcaaatccaaagttattagc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4695182 |
gattaacaaggcaaatagatatcgaacgaaataagtatttactcaaatccaaagttattagc |
4695121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 55 - 92
Target Start/End: Complemental strand, 4695763 - 4695725
Alignment:
| Q |
55 |
aaataatcactaa-ttatttaacaacagaatcaaataca |
92 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4695763 |
aaataatcactaaattatttaacaacagaatcaaataca |
4695725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University