View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7715_high_6 (Length: 294)
Name: NF7715_high_6
Description: NF7715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7715_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 38 - 284
Target Start/End: Complemental strand, 27118927 - 27118682
Alignment:
| Q |
38 |
caagaaaagttgaatgaatgaatactagaaacccgggaagatgcggtgagggtaaagtaatggtgatatatagattagtgggatctattagtggatcctt |
137 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27118927 |
caagaaaagttgaatgaaagaatactagaaacccgggaagatgtggtgagggtaaagtaatggtgatatatagattagtgggatctattagtggatcctt |
27118828 |
T |
 |
| Q |
138 |
tcataaaaataaagtaaggtagataataaaacaaactctggttcatttgtttaatctggataattctgttgatcagctattcgaaannnnnnngctgaaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
27118827 |
tcataaaaataaagtaaggtagataataaaacaaactctcgttcatttgtttaatatggataattatgttgaacagctattcgaaatttttttgctgaaa |
27118728 |
T |
 |
| Q |
238 |
ctaaaagtatctgttcattcttattgttatttgaagttctttctctg |
284 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||| |||| |
|
|
| T |
27118727 |
ctaaaagtatatgttcattcttattgtta-ttgaagttctttttctg |
27118682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University