View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7715_low_12 (Length: 247)
Name: NF7715_low_12
Description: NF7715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7715_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 230
Target Start/End: Original strand, 35437578 - 35437799
Alignment:
| Q |
9 |
tattattctcaaaaggaaatttcatttcacaattgctaagcattactccctcggaatcaattataagcaaaattaattcatatttatcgaaggggattgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35437578 |
tattattctcaaaaggaaatttcatttcacgattgctaagcattactccctcggaatgaattataagcaaaattaattcatatttatcgaaggggattgc |
35437677 |
T |
|
| Q |
109 |
gtaactctacttgcttcagcagagggattaaaggagtgtatgagttaaaagtacaaatttcaagtcctaacaatgnnnnnnnntactaacataacaatta |
208 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
35437678 |
gtaactctactggcttcagcagagggattaaaggagtgtatgagttaaaagttcaagtttcaagtcctagcaatgaaaaaaaatactaacataacaatta |
35437777 |
T |
|
| Q |
209 |
acatactaccataccttaaaag |
230 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
35437778 |
acatactaccacaccttaaaag |
35437799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University