View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7716_high_1 (Length: 489)
Name: NF7716_high_1
Description: NF7716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7716_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 13 - 361
Target Start/End: Original strand, 46203321 - 46203669
Alignment:
| Q |
13 |
aatatgcgtagagtgtgcagtagtagcagctagctagctatacatgtgaatgtgatataggcatgctcattggatgacgataacaaagctgctatctagc |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46203321 |
aatatgcgtagagtgtgcagtagtactagctagctagctatacatgtgaatgtgatataggcctgctcattggatgacgataacaaagctgctatctagc |
46203420 |
T |
|
| Q |
113 |
tatgtggctatgatctgatatttctattttcaaagtacgtacgtatggtttcttgaattagataaagtacttaagaacgtgactagctagggttgtgatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46203421 |
tatgtggctatgatctgatatttctattttcaaagtacgtacgtatggtttcttgaattagataaagtacttaagaacgtgactagctagggttgtgatg |
46203520 |
T |
|
| Q |
213 |
gtggtgcctgcagtatcttttcagcgatgaagagatctatcatcaagaacaaattccacttcttcaaagctagtctttcattactttactttatactatc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46203521 |
gtggtgcctgcagtatcttttcagcgatgaagagatctatcatcaagaacaaattccacttcttcaaagctagtctttcattactttactttatactatc |
46203620 |
T |
|
| Q |
313 |
tgatcacctgatctctatatgtactttgtttttgtctctttatcataca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46203621 |
tgatcacctgatctctatatgtactttgtttttgtctctttatcataca |
46203669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University