View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7716_high_8 (Length: 241)
Name: NF7716_high_8
Description: NF7716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7716_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 34693766 - 34693571
Alignment:
| Q |
20 |
gggaggccatgcagaccattttgatggttggagttggacgaatttgtcgattttttgaacttgtttgaccaatgtactttcttgaagggagccatcactg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34693766 |
gggaggccatgcagaccattttgatggttggagttcgaggaatttgtcgattttttgaacttgtttgaccaatgtactttcttgaagggagccatcactg |
34693667 |
T |
 |
| Q |
120 |
atcgatggttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagacgattattagagagaa |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34693666 |
atcgattgttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagatgattattagagagaa |
34693571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 25 - 218
Target Start/End: Complemental strand, 34685967 - 34685775
Alignment:
| Q |
25 |
gccatgcagaccattttgatggttggagttggacgaatttgtcgattttttgaacttgtttgaccaatgtactttcttgaagggagccatcactgatcga |
124 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| | ||||| || ||||| || ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34685967 |
gccatgcagacgattttgatggttggagttcgacgaactggtcgacttaatgaacctgcttggccaatgtactttcttcctgggagccatcactgatcga |
34685868 |
T |
 |
| Q |
125 |
tggttgatatgctgggatagatggagaaattaagacgaattattgaacttgaacctgaatattgaaagatatagacgattattagagagaagta |
218 |
Q |
| |
|
| |||||||||||| ||||||| |||||| |||| ||||||||||||| ||||| ||||| ||||||| ||| |||||||||||| ||||| |
|
|
| T |
34685867 |
tcgttgatatgctgcgatagatagagaaagtaagggaaattattgaactt-aacctaaatatcaaaagatagagatgattattagagataagta |
34685775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University