View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7716_low_8 (Length: 393)
Name: NF7716_low_8
Description: NF7716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7716_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 176 - 322
Target Start/End: Original strand, 37658296 - 37658442
Alignment:
| Q |
176 |
ctatggacctatggtaggaagattcggtacttatgaaaccgtttttatgttgcagtcgattccgtactcttagattaagagaatatgtaatttcttaatc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658296 |
ctatggacctatggtaggaagattcggtacttatgaaaccgtttttatgttgcagtcgattccgtactcttagattaagagaatatgtaatttcttaatc |
37658395 |
T |
|
| Q |
276 |
tattagcaaacaatcggctgcactataaattcagttgtagacaattc |
322 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37658396 |
tattagcaaacaatcggctgcactacaaattcagttgtagacaattc |
37658442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 37658125 - 37658242
Alignment:
| Q |
1 |
aaaggatagtgatggtggtggtgttgttgctcattgacatgctctgtttcaactattttgtttctttatgtatacattttagtctaggaactaggaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658125 |
aaaggatagtgatggtggtggtggtgttgctcattgatatgctctgtttcaactattttgtttctttatgtatacattttagtctaggaactaggaagaa |
37658224 |
T |
|
| Q |
101 |
aatggtgtaattcacaag |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37658225 |
aatggtgtaattcacaag |
37658242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 349 - 377
Target Start/End: Original strand, 37658473 - 37658501
Alignment:
| Q |
349 |
attgtaatatgattataatataatgtatc |
377 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37658473 |
attgtaatatgattataatataatgtatc |
37658501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University