View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7717_high_7 (Length: 252)
Name: NF7717_high_7
Description: NF7717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7717_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 237
Target Start/End: Complemental strand, 42315324 - 42315109
Alignment:
| Q |
20 |
gttctcttccaagaaaacgcgatggtggactagtcatgtgaaggaaaatctttggaaataatatttcgatattcatctgcaata--agagttattggtat |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42315324 |
gttctcttccaaaaaaacgcgatggtggactagtcacgtgaaggaaaatctttggaaataatatttcgatattcatctgcaataagagagttattggtat |
42315225 |
T |
|
| Q |
118 |
cagcaagataaatccaaatagtatttttgtgaccgtacgtaatacccatttttccgttaatctattattattcatataatgcataatcacatttcaactc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42315224 |
cagcaagataaatccaaatagtatttttgtgac----tgtaatacccatttttccgtcaatctattattattcatataatgcataatcacatttcaactc |
42315129 |
T |
|
| Q |
218 |
ttaatgatatttttaccaat |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42315128 |
ttaatgatatttttaccaat |
42315109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University