View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7718_low_11 (Length: 244)
Name: NF7718_low_11
Description: NF7718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7718_low_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 244
Target Start/End: Original strand, 29563196 - 29563427
Alignment:
| Q |
13 |
acatcacttctaaaattttaaagtttccacaggtttcttatatttcccaaaactggcctgttcaatatgtggcagctagtcaggatggaatgtacttagc |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29563196 |
acatcacttctaaaattttaaaatttccacaggtttcttatatttcccaaaactggcctgttcaatatgtggcagctagtcaggatggaatgtacttggc |
29563295 |
T |
 |
| Q |
113 |
ggttgctggtcttcatggtttgatattgtatgatatacgaatgaaaagatggagagtctttagagatgttacccaggaacaaaagattcagtgtaagggc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29563296 |
ggttgctggtcttcatggtttgatattgtatgatatacgaatgaaaagatggagagtctttggagatgttacccaggaacaaaagattcagtgtaagggc |
29563395 |
T |
 |
| Q |
213 |
ttgctatggctgggaaagattgtcgttgtctg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29563396 |
ttgctatggctgggaaagattgtcgttgtctg |
29563427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University