View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7718_low_9 (Length: 249)
Name: NF7718_low_9
Description: NF7718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7718_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 100 - 237
Target Start/End: Complemental strand, 54101112 - 54100975
Alignment:
| Q |
100 |
catgtagcaattgtgaactgctgaacagagttacatcaacagagatgagaaaatatgaacgacaattgaggcatttgagagacctgggatctggctccca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54101112 |
catgtagcaattgtgaactgctgaacagagttacatcaacagagatgagaaaatatgaacgacaattgaggcatttgagagacctgggatctggctccca |
54101013 |
T |
 |
| Q |
200 |
aattacagaacaaaaccccttatcacttcactcatatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54101012 |
aattacagaacaaaaccccttatcacttcactcatatt |
54100975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 54101211 - 54101171
Alignment:
| Q |
1 |
catcaagccctcgcataattaaatggtcagtatcttcctta |
41 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54101211 |
catcaagccctcacataattaaatggtcagtatcttcctta |
54101171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University