View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7719_low_23 (Length: 359)
Name: NF7719_low_23
Description: NF7719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7719_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 17336775 - 17336817
Alignment:
| Q |
237 |
gatgatttggataaccaatcatgtagtcattacattcttgtta |
279 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17336775 |
gatgatttggacgaccaatcatgtagtcattacattcttgtta |
17336817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 103 - 176
Target Start/End: Original strand, 17336553 - 17336626
Alignment:
| Q |
103 |
tttggttggataagtaagtcggtgaaaaatactcgacgattcacaacttagtgttaggttgcataaggactaaa |
176 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||| | ||||||||||||||| || ||||| | |||||||||| |
|
|
| T |
17336553 |
tttggtttgataagtaagttggtgtaaaatacttggtgattcacaacttagtctttggttggacaaggactaaa |
17336626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 74
Target Start/End: Original strand, 43484129 - 43484161
Alignment:
| Q |
42 |
tgtttgatgggttgaaaagaaaggcataaatga |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43484129 |
tgtttgatgggttgaaaagaaaggcataaatga |
43484161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 102 - 135
Target Start/End: Original strand, 7459546 - 7459579
Alignment:
| Q |
102 |
gtttggttggataagtaagtcggtgaaaaatact |
135 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
7459546 |
gtttggttggataagtaagttggtgaaaaatact |
7459579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University