View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7719_low_38 (Length: 249)
Name: NF7719_low_38
Description: NF7719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7719_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 17486362 - 17486576
Alignment:
| Q |
19 |
ttagggagtaggttaaaaattctcgcattagatgatagatggtctgaaaa-gtgtttataagtgaagttaatcttcacattgtaaattggttttatgtga |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||| |||| |||||| ||| ||| |||||||||| |
|
|
| T |
17486362 |
ttagggagtaggttaaaaattctagcattagatgatagatggtctgaaaaagtgtttataagtaaagtcaatcctcacatcataagttgattttatgtga |
17486461 |
T |
|
| Q |
118 |
ttgtgttaggcctaacaataatttctaatagaaagtgaatcacaaaaacatattttctgattttactttctttatggataaggtttaaatatgtttatgt |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
17486462 |
ttgtgttagacctaacaataatttctaatagaaagtgaatcacaaaaacatattttctgattttac-ttctttatgaataaggtttaaatatgtttatgt |
17486560 |
T |
|
| Q |
218 |
agttttgtgagttatg |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17486561 |
agttttgtgagttatg |
17486576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University