View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7719_low_42 (Length: 245)
Name: NF7719_low_42
Description: NF7719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7719_low_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 7151253 - 7151023
Alignment:
| Q |
11 |
acagggcccgagtagtagattagtcactgcttaatgaagtgggatacttattatctataacgtcgttgtctnnnnnnngtagtcttcttaagtattgaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7151253 |
acagggcccgagtagtagattagtcactgcttaatgaagtgggatacttattatctataacgtggttgtctaaaaaaagtagtcttcttaagtattgaga |
7151154 |
T |
|
| Q |
111 |
ttcgatctatcatttgaaatgtgccatgctttaagctgaaatcgatattattcagttgtttaagaactgggttgctgccactg--------tttttatta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7151153 |
ttcgatctatcatttgaaatgtgccatgctttaagctgaaatcgatattattcagttgtttaagaactgggttgctgccactgtttaactttttttatta |
7151054 |
T |
|
| Q |
203 |
gtaatttccagtaatatttactcgtgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |
|
|
| T |
7151053 |
gtaatttccagtaatatttactcatgatgtc |
7151023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University