View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7719_low_43 (Length: 245)
Name: NF7719_low_43
Description: NF7719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7719_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 55026407 - 55026341
Alignment:
| Q |
18 |
taatgactatcttttggatgctctttgagaactttaaacgctaagtttgcattgaaaatcaaaatac |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55026407 |
taatgactatcttttggatgctctttgagaactttaaacgctaagtttgcattgaaaatcaaaatac |
55026341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 113 - 163
Target Start/End: Complemental strand, 55026312 - 55026262
Alignment:
| Q |
113 |
gtaatctttaaagagtgttagtgagaccttaaaattaaactcaagacttgt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55026312 |
gtaatctttaaagagtgttagtgagaccataaaattaaactcaagacttgt |
55026262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 55026265 - 55026223
Alignment:
| Q |
190 |
ttgttaaaggattttaaccacattgaattgtgtactctaatat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55026265 |
ttgttaaaggattttaaccacattgaattgtgtactctaatat |
55026223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University