View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7719_low_43 (Length: 245)

Name: NF7719_low_43
Description: NF7719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7719_low_43
NF7719_low_43
[»] chr4 (3 HSPs)
chr4 (18-84)||(55026341-55026407)
chr4 (113-163)||(55026262-55026312)
chr4 (190-232)||(55026223-55026265)


Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 55026407 - 55026341
Alignment:
18 taatgactatcttttggatgctctttgagaactttaaacgctaagtttgcattgaaaatcaaaatac 84  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55026407 taatgactatcttttggatgctctttgagaactttaaacgctaagtttgcattgaaaatcaaaatac 55026341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 113 - 163
Target Start/End: Complemental strand, 55026312 - 55026262
Alignment:
113 gtaatctttaaagagtgttagtgagaccttaaaattaaactcaagacttgt 163  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||    
55026312 gtaatctttaaagagtgttagtgagaccataaaattaaactcaagacttgt 55026262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 55026265 - 55026223
Alignment:
190 ttgttaaaggattttaaccacattgaattgtgtactctaatat 232  Q
    |||||||||||||||||||||||||||||||||||||||||||    
55026265 ttgttaaaggattttaaccacattgaattgtgtactctaatat 55026223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University