View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7719_low_45 (Length: 238)
Name: NF7719_low_45
Description: NF7719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7719_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 40958036 - 40957814
Alignment:
| Q |
1 |
acgatttggaagttgtttgtgtatgggaacaaaatgcaccacacacgtatgcttaacagattctgcaggaacagcgtcttggtggaaactataatataac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40958036 |
acgatttggaagttgtttgtgtatgggaacaaaatgcaccacacacgtatgcttaacagattctgcaggaacagcgtcttggtggaaactataatataac |
40957937 |
T |
 |
| Q |
101 |
tctctcgtctcatttgattgccaggtaccacctccttttttctctgcttcatatggacggtaaaaccactgccctgtgatcattaaggtgtcattcgggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
40957936 |
tctctcgtctcatttgattgccaggtaccacctccttttttctctgcttcatatggacggtaaaaccactgacctgtgatcattaaggtgtcattggggg |
40957837 |
T |
 |
| Q |
201 |
attgtgtaatgtcctgacagaaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40957836 |
attgtgtaatgtcctgacagaaa |
40957814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 40945043 - 40944861
Alignment:
| Q |
1 |
acgatttggaagttgtttgtgtatgggaacaaaatgcaccacacacgtatgcttaacagattctgcaggaacagcgtcttggtggaaactataatataac |
100 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||| | ||| |||||||||||||| | | | |
|
|
| T |
40945043 |
acgatttggaagctgtttgtgtatggggacaaaatgcaccacacacttatgcataacagattctgcaggaacctcatctcggtggaaactataaaacagc |
40944944 |
T |
 |
| Q |
101 |
tctctcgtctcatttgattgccaggtaccacctccttttttctctgcttcatatggacggtaaaaccactgccctgtgatcat |
183 |
Q |
| |
|
||||| || ||| ||||||||| |||||||||| ||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
40944943 |
tctctggtgtcaacggattgccagctaccacctccctttttttctgcttcatctggacggtagaaccactgccctgtgatcat |
40944861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 6 - 106
Target Start/End: Original strand, 22508169 - 22508269
Alignment:
| Q |
6 |
ttggaagttgtttgtgtatgggaacaaaatgcaccacacacgtatgcttaacagattctgcaggaacagcgtcttggtggaaactataatataactctct |
105 |
Q |
| |
|
||||||||| |||||||| |||| ||||| ||| |||| |||||| ||||| |||||| |||||| | | |||||||||||||||| |||||||||| |
|
|
| T |
22508169 |
ttggaagttttttgtgtaccggaatgaaatgaaccgcacatgtatgcataacattttctgccggaacaacatattggtggaaactataaaataactctct |
22508268 |
T |
 |
| Q |
106 |
c |
106 |
Q |
| |
|
| |
|
|
| T |
22508269 |
c |
22508269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University