View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7720_low_13 (Length: 251)
Name: NF7720_low_13
Description: NF7720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7720_low_13 |
 |  |
|
| [»] chr5 (11 HSPs) |
 |  |
|
| [»] chr4 (26 HSPs) |
 |  |
|
| [»] chr6 (7 HSPs) |
 |  |
|
| [»] chr8 (17 HSPs) |
 |  |
|
| [»] chr7 (25 HSPs) |
 |  |
|
| [»] chr2 (21 HSPs) |
 |  |
|
| [»] scaffold0113 (1 HSPs) |
 |  |
|
| [»] scaffold0037 (1 HSPs) |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0651 (1 HSPs) |
 |  |
|
| [»] scaffold0151 (1 HSPs) |
 |  |
|
| [»] scaffold0400 (1 HSPs) |
 |  |
|
| [»] scaffold0365 (1 HSPs) |
 |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 32)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 48712887 - 48713089
Alignment:
| Q |
1 |
gtaatcataggtcaagaaagtttttgatttttgtgaattgacaaatacattcatgaaattgtaaaatgtaattcaaaatggtccctccgtcaaaatttga |
100 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48712887 |
gtaatcataggtcaaaaaagtttctgatttttgtgaattgacaaatacattcatgaaattgtaaaatgtaattcaaaatggtccctccgtcaaaatttga |
48712986 |
T |
 |
| Q |
101 |
tgttagaaattatgacgtggtgcgttaattgaacatgccacattgtatgttatcctgcgtcaatgtaaactcatcatggactaattagcctacgaaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48712987 |
tgttagaaattatgacgtggtgcgttaattgaacatgccgcattgtatgttatcctgcgtcaatgtaaactcatcatggactaattagcctacgaaattt |
48713086 |
T |
 |
| Q |
201 |
agg |
203 |
Q |
| |
|
||| |
|
|
| T |
48713087 |
agg |
48713089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 996405 - 996355
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
996405 |
agggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
996355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 12734159 - 12734110
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12734159 |
gggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
12734110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 19253710 - 19253763
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19253710 |
tttagggggtttattggatcatgattctaagggattttaaaagacttttttatc |
19253763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 3206514 - 3206466
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3206514 |
ggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
3206466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 33808128 - 33808072
Alignment:
| Q |
195 |
aaatttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33808128 |
aaatgtagggggtgtattgaatcatgattctaagggattttaaaagacttttttatc |
33808072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 16010750 - 16010799
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
16010750 |
gggggtgtattggatcataattctaagggattttaaaagacttttttatc |
16010799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 20498097 - 20498142
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20498097 |
gggggtgtattggatcatgattctaagggattttaaaagacttttt |
20498142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 22057651 - 22057696
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22057651 |
ggggtgtattggatcatgattctaagggattttaaaagactttttt |
22057696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 251
Target Start/End: Complemental strand, 51699802 - 51699749
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
51699802 |
tttagggggtgtattggatcatgattataaaagattttaaaagatttttttatc |
51699749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 10139468 - 10139416
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10139468 |
ttagggggtgtattgaatcatgattctaagggattttaaaatacttttttatc |
10139416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 33996809 - 33996761
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
33996809 |
ggggtgtattggatcatgattctaagggattttgaaagacttttttatc |
33996761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 29449180 - 29449131
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
29449180 |
agggggtgtattagatcatgattataagggattttaaaagacttttttat |
29449131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 40246731 - 40246780
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
40246731 |
gggggtgtattggatcatgattctaagagattttaaaaaacttttttatc |
40246780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 29029898 - 29029942
Alignment:
| Q |
207 |
tgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
29029898 |
tgtattggatcatgattctaagggattttaaaagacttttatatc |
29029942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 6589449 - 6589496
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
6589449 |
aggggatgtattggatcatgattctaagggactttaaaagactttttt |
6589496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 37820794 - 37820747
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
37820794 |
gggtatattggataatgattctaagggattttaaaagacttttttatc |
37820747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 25418248 - 25418302
Alignment:
| Q |
197 |
atttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
25418248 |
atttagggggtttattggatcatgattctaagagattttaaaaaatttttttatc |
25418302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 35337620 - 35337670
Alignment:
| Q |
201 |
agggggtgtattgga-tcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
35337620 |
agggggtgtatttgaatcatgattctaagggattttaaaagacttttttat |
35337670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 198 - 247
Target Start/End: Complemental strand, 15494054 - 15494005
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||| |||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
15494054 |
tttaggggatgtattggattataattctaagggattttaaaagacttttt |
15494005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 27899277 - 27899321
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27899277 |
gtgtattagattatgattctaaatgattttaaaagacttttttat |
27899321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 48379050 - 48379090
Alignment:
| Q |
207 |
tgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
48379050 |
tgtattggattatgattctataggattttaaaagacttttt |
48379090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 251
Target Start/End: Original strand, 52114418 - 52114466
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
52114418 |
ggggtgtactggatcatgattctaaggaattttaaaagatttttttatc |
52114466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 54625481 - 54625528
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| ||||||||| |
|
|
| T |
54625481 |
gggtgtattggatcatgattctaagagattttagaagatttttttatc |
54625528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 19552235 - 19552186
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||| |||||||| |
|
|
| T |
19552235 |
agggggtgtattggattgagattttaaaggattttaaaagatttttttat |
19552186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 23753705 - 23753660
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||| |||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
23753705 |
ggggatgtattggattaggattctataggattttaaaagacttttt |
23753660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 26006072 - 26006023
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
26006072 |
ttagggggtgtattggattgagatttcaaaggattttaaaagactttttt |
26006023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 247
Target Start/End: Complemental strand, 36674456 - 36674404
Alignment:
| Q |
196 |
aatttaggggg-tgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||||||| |||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
36674456 |
aatttagggggatgtattggattaggattctatgggattttaaaagacttttt |
36674404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 247
Target Start/End: Complemental strand, 39842751 - 39842703
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||| |||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
39842751 |
ttaggggatgtattggattaggattctatgggattttaaaagacttttt |
39842703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 247
Target Start/End: Complemental strand, 45927034 - 45926990
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45927034 |
ggggtgtattggattgagattttaaaggattttaaaagacttttt |
45926990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 50900531 - 50900487
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
50900531 |
gggtgtattggattaagatttcaaaggattttaaaagactttttt |
50900487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 239
Target Start/End: Original strand, 52079881 - 52079917
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaa |
239 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52079881 |
ggggtgtattggatcatgattctaagtgattttaaaa |
52079917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 11)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 7017026 - 7016966
Alignment:
| Q |
191 |
tacgaaatttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7017026 |
tacgcaatttagggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
7016966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 21146955 - 21147004
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21146955 |
gggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
21147004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 43319134 - 43319180
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43319134 |
gggggtgtattggatcatgattctaagggattttaaaagactttttt |
43319180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 27459265 - 27459218
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
27459265 |
gggtgtattggatcatgattctaacggattttaaaaaacttttttatc |
27459218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 16894174 - 16894128
Alignment:
| Q |
205 |
ggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
16894174 |
ggtgtattggatcataattctaagggattttaaaagacttttttatc |
16894128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5273276 - 5273231
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
5273276 |
gtgtattggatcatgattttaagggattttaaaagacttttttatc |
5273231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 33656368 - 33656312
Alignment:
| Q |
196 |
aatttagg-gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| ||||||||||||| ||||||||| |
|
|
| T |
33656368 |
aatttaggagggtgtattggatcatgattttaagggattttaaaagatttttttatc |
33656312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 6460682 - 6460728
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
6460682 |
gggtgtattgaatcatgattctaagggattttaaaagatttttttat |
6460728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 32158218 - 32158168
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||| ||||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32158218 |
agggggtatattgaatcatgattctaaggaattttaaaagacttttttatc |
32158168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 7948630 - 7948587
Alignment:
| Q |
207 |
tgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
7948630 |
tgtattggattaggattctataggattttaaaagacttttttat |
7948587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 9689553 - 9689594
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
9689553 |
gtgtattggattatgattctaagggattttaatagacttttt |
9689594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 26)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 196 - 251
Target Start/End: Original strand, 22201896 - 22201951
Alignment:
| Q |
196 |
aatttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22201896 |
aatttagggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
22201951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 25331017 - 25331067
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25331017 |
agggggtgtattggatcatgattctaaaagattttaaaagacttttttatc |
25331067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 196 - 250
Target Start/End: Complemental strand, 30010002 - 30009948
Alignment:
| Q |
196 |
aatttagggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
30010002 |
aatttagggggtgtattggatcatgattctaagggattttaaaagacatttttat |
30009948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 198 - 248
Target Start/End: Original strand, 42786650 - 42786700
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42786650 |
tttagggggtgtattggatcatgattctaagggattttaaaagactttttt |
42786700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 197 - 250
Target Start/End: Original strand, 41320632 - 41320685
Alignment:
| Q |
197 |
atttagggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
41320632 |
atttagggggtgtattggatcatgattctaaaagattttaaaagatttttttat |
41320685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 24131289 - 24131242
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24131289 |
gggtgtattggatcatgattctaagggattttaaaagacttttttatc |
24131242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 1044697 - 1044746
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
1044697 |
gggggtgtattggatcatgattctaagggattttaaaagatttttttatc |
1044746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 7250090 - 7250043
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
7250090 |
gggtgtattggatcatgattctaaggaattttaaaagacttttttatc |
7250043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 28541587 - 28541633
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
28541587 |
gggtgtattggatcatgattctaagggattttaaaagacatttttat |
28541633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 40537465 - 40537415
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
40537465 |
agggggtgtattggatcatgattgtaagggattttaaaagacttttgtatc |
40537415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 41881403 - 41881357
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
41881403 |
gggggtgtattggatcatgattttaagggattttaaaagactttttt |
41881357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 46635959 - 46635913
Alignment:
| Q |
205 |
ggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46635959 |
ggtgtattggatcatgattctaagagattttaaaagacttttttatc |
46635913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31315043 - 31314998
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
31315043 |
gtgtattggatcatgattctaagggattttaaaagatttttttatc |
31314998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 44775986 - 44775947
Alignment:
| Q |
208 |
gtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44775986 |
gtattggatcatgattctaatggattttaaaagacttttt |
44775947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 39479677 - 39479627
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
39479677 |
agggggtgtattggatcatgattttaagaaattttaaaagacttttttatc |
39479627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 197 - 250
Target Start/End: Complemental strand, 28847193 - 28847140
Alignment:
| Q |
197 |
atttagggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
||||||||| |||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
28847193 |
atttaggggatgtattggattgagattttaaaggattttaaaagacttttttat |
28847140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 213 - 250
Target Start/End: Complemental strand, 32951144 - 32951107
Alignment:
| Q |
213 |
ggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32951144 |
ggatcatgattctaagggattttaaaagacttttttat |
32951107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 37915672 - 37915717
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
37915672 |
gggggtgtattggattatgattctatgggattttaaaagacttttt |
37915717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 1112784 - 1112825
Alignment:
| Q |
205 |
ggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1112784 |
ggtgtattggatcatgattctaa--gattttaaaagactttttt |
1112825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 49469210 - 49469254
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
49469210 |
gggtgtattggatcatgattccaaggaattttaaaagactttttt |
49469254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 25445983 - 25446029
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
25445983 |
gggtgtattggat-atgattttaagggattttaaaagacttttttatc |
25446029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 86
Target Start/End: Original strand, 25893708 - 25893767
Alignment:
| Q |
27 |
atttttgtgaattgacaaatacattcatgaaattgtaaaatgtaattcaaaatggtccct |
86 |
Q |
| |
|
||||||| |||||| |||||||| |||||||||||||||||| |||||||| |||||| |
|
|
| T |
25893708 |
atttttgcaaattgataaatacatccatgaaattgtaaaatgttgttcaaaatagtccct |
25893767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 248
Target Start/End: Original strand, 25935779 - 25935830
Alignment:
| Q |
197 |
atttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
25935779 |
atttagggggtgtattggattgagatttcaaaggattttaaaagactttttt |
25935830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 37046769 - 37046722
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| |||||||| |
|
|
| T |
37046769 |
gggtgtattggatcatgattctaaggaattttaaaagatatttttatc |
37046722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 55302732 - 55302778
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
55302732 |
gggtgtattgaatcatgattttaagggattttagaagacttttttat |
55302778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 19741226 - 19741181
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
19741226 |
ggggatgtattcaatcatgattctaaaagattttaaaagacttttt |
19741181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 197 - 251
Target Start/End: Complemental strand, 2301061 - 2301007
Alignment:
| Q |
197 |
atttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2301061 |
atttagggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
2301007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 1391513 - 1391560
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1391513 |
gggtgtattggatcatgattctaaaggattttaaatgacttttttatc |
1391560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 6197796 - 6197747
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
6197796 |
gggggtgtattggatcatgattctaagggattttaaaaaacttttttatc |
6197747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 29076484 - 29076530
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29076484 |
gggggtgtattggatcatgattctaagagattttaaaagactttttt |
29076530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 29111457 - 29111503
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29111457 |
gggggtgtattggatcatgattctaagagattttaaaagactttttt |
29111503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 7051728 - 7051781
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||| || ||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
7051728 |
tttagggggtgtgtttgattaggattctaagagattttaaaagacttttttatc |
7051781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 247
Target Start/End: Complemental strand, 34759332 - 34759284
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
34759332 |
ttagggggtgtattggattaggattctatgagattttaaaagacttttt |
34759284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 24)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 198 - 248
Target Start/End: Complemental strand, 6304577 - 6304527
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6304577 |
tttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
6304527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 22183251 - 22183300
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22183251 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
22183300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 198 - 251
Target Start/End: Complemental strand, 28824695 - 28824642
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28824695 |
tttagggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
28824642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 199 - 251
Target Start/End: Original strand, 953697 - 953749
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
953697 |
ttagggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
953749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 19452169 - 19452120
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19452169 |
gggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
19452120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 730030 - 730076
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
730030 |
gggggtgtattggatcatgattctaagggattttaaaagactttttt |
730076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 21222029 - 21222078
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
21222029 |
gggggtgtattggatcatgattctaagggattttaaaaggcttttttatc |
21222078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 28541381 - 28541434
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
28541381 |
tttagggggtgtattggatcatgattctaagcgattttaaaagatttttttatc |
28541434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 45760329 - 45760280
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
45760329 |
gggggtgtattggatcatgattctaagggattttaaaagatttttttatc |
45760280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 203 - 251
Target Start/End: Original strand, 35279554 - 35279602
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35279554 |
ggggtgtattggatcatgattctaagagattttaaaagacttttttatc |
35279602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 49198585 - 49198537
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
49198585 |
ggggtgtattggatcatgattctaaggaattttaaaagacttttttatc |
49198537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 47654669 - 47654627
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47654669 |
gtgtattggatcatgattctaagggattttaaaagactttttt |
47654627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 49417964 - 49418014
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49417964 |
agggggtatattggatcatgattctaagagattttaaaagacttttttatc |
49418014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 33025393 - 33025442
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
33025393 |
gggggtgtattggatcatgattctaagagaatttaaaagacttttttatc |
33025442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 50192870 - 50192822
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
50192870 |
gggggtgtattgaatcatgattctaaggaattttaaaagacttttttat |
50192822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 250
Target Start/End: Complemental strand, 35679445 - 35679399
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35679445 |
gggtgtattgaatcatgattttaagggattttaaaagacttttttat |
35679399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 14494093 - 14494139
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
14494093 |
gggggtgtattggatcatgattctaaggg---ttaaaagacttttttatc |
14494139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 47780502 - 47780549
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
47780502 |
gggtgtattggatcatgattctaagaaattttaaaagatttttttatc |
47780549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 247
Target Start/End: Original strand, 48524208 - 48524246
Alignment:
| Q |
209 |
tattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
48524208 |
tattggatcatgattctaaggaattttaaaagacttttt |
48524246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 195 - 247
Target Start/End: Original strand, 6312447 - 6312500
Alignment:
| Q |
195 |
aaatttaggggg-tgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
6312447 |
aaatttagggggatgtattggattaggattctatgggattttaaaagacttttt |
6312500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 247
Target Start/End: Complemental strand, 9577755 - 9577706
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||| |||||||||| | ||||| || ||||||||||||||||||| |
|
|
| T |
9577755 |
tttaggggatgtattggattaggattcgaagggattttaaaagacttttt |
9577706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 214 - 251
Target Start/End: Complemental strand, 31572470 - 31572433
Alignment:
| Q |
214 |
gatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31572470 |
gatcatgattctaagggattttaagagacttttttatc |
31572433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 249
Target Start/End: Original strand, 34772311 - 34772356
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagactttttta |
249 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
34772311 |
gggtgtattggattgtgatttcaaaggattttaaaagactttttta |
34772356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 247
Target Start/End: Original strand, 45272465 - 45272513
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||| |||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
45272465 |
ttaggggatgtattggattaagattctatgggattttaaaagacttttt |
45272513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 17)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 24502089 - 24502040
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24502089 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
24502040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 24214908 - 24214860
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24214908 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
24214860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 23115487 - 23115437
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23115487 |
agggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
23115437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 42735595 - 42735546
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42735595 |
gggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
42735546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 7507220 - 7507168
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7507220 |
ttagagggtgtattggatcatgattctaagggattttaaaagacttttttatc |
7507168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 2705137 - 2705088
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
2705137 |
gggggtgtattggatcatgattgtaaaggattttaaaagatttttttatc |
2705088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 26374746 - 26374697
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26374746 |
ggggatgtattggatcatgattctaagggattttaaaagacttttttatc |
26374697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 41478989 - 41479034
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41478989 |
gtgtattggatcatgattctaagggattttaaaagacttttttatc |
41479034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 188 - 248
Target Start/End: Original strand, 8543393 - 8543453
Alignment:
| Q |
188 |
gcctacgaaatttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||| || |||||||||||| |||||||||||||| ||||||||||||| |||||| |
|
|
| T |
8543393 |
gcctacgaacttaagggggtgtattagatcatgattctaagggattttaaaagattttttt |
8543453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 42937250 - 42937297
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
42937250 |
gggtgtattggatcatgattttaagggattttaaaagacttttttatc |
42937297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 26373692 - 26373742
Alignment:
| Q |
202 |
gggggtgtattgg-atcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26373692 |
gggggtgtattgggatcatgattctaagggattttaaaagacttttttatc |
26373742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 5576942 - 5576893
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||| |||||| |
|
|
| T |
5576942 |
ttagggggtgtattggattatgattctaagggattttaaaagattttttt |
5576893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 195 - 248
Target Start/End: Complemental strand, 29260369 - 29260316
Alignment:
| Q |
195 |
aaatttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29260369 |
aaatttagggggtgtattggattgagattttaaaggattttaaaagactttttt |
29260316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 32711599 - 32711551
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
32711599 |
ggggtgtattggatcatgattctaagagactttaaaagacttttttatc |
32711551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 43959549 - 43959591
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
43959549 |
gtgtatttgatcatgattttaaaggattttaaaagactttttt |
43959591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 1606102 - 1606053
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
1606102 |
ttagggggtgtattggattgagatttcaaaggattttaaaagactttttt |
1606053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 247
Target Start/End: Complemental strand, 39190084 - 39190044
Alignment:
| Q |
207 |
tgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
39190084 |
tgtattggattaggattctaagggattttaaaagacttttt |
39190044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 25)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 8078280 - 8078333
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8078280 |
tttagggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
8078333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 196 - 251
Target Start/End: Original strand, 31401579 - 31401634
Alignment:
| Q |
196 |
aatttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
31401579 |
aatttagggggtgtattggatcatgattctaaagaactttaaaagacttttttatc |
31401634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 44343715 - 44343665
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44343715 |
agggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
44343665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 30440685 - 30440734
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30440685 |
gggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
30440734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 43581406 - 43581359
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43581406 |
gggtgtattggatcatgattctaaagaattttaaaagacttttttatc |
43581359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 34008903 - 34008953
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
34008903 |
agggggtgtattggatcatgattctaagggattttaaaagatttttttatc |
34008953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 251
Target Start/End: Complemental strand, 18915057 - 18915004
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
18915057 |
tttagggggtgtattggatcatgtatctaagggattttaaaagacttttttatc |
18915004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20275577 - 20275532
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20275577 |
gtgtattggatcatgattctaagggattttaaaagacttttttatc |
20275532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 34695119 - 34695168
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34695119 |
agggggtgtattgaatcatgattctaagggattttaaaagacttttttat |
34695168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 32143235 - 32143192
Alignment:
| Q |
205 |
ggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32143235 |
ggtgtattggatcatgattctaagggattttaaaagactttttt |
32143192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 727405 - 727450
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
727405 |
gtgtattggatcatgattctaatggattttaaatgacttttttatc |
727450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 973074 - 973118
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
973074 |
gggtgtattggatcatgattctaagggattttaaaagattttttt |
973118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 7719574 - 7719530
Alignment:
| Q |
207 |
tgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
7719574 |
tgtattggatcatgattgtaaaagattttaaaagacttttttatc |
7719530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 9179763 - 9179814
Alignment:
| Q |
200 |
tagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
9179763 |
tagggggtgtattggattagcattctaaaagattttaaaagacttttttatc |
9179814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 31638766 - 31638813
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31638766 |
gggtgtattgaatcatgattctaagagattttaaaagacttttttatc |
31638813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 39219651 - 39219604
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
39219651 |
gggtgtattggatcataattctaaggaattttaaaagacttttttatc |
39219604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 40996969 - 40996922
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| | |||||| |
|
|
| T |
40996969 |
agggggtgtattggatcatgattctaagggattttaaaatattttttt |
40996922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 195 - 248
Target Start/End: Original strand, 7113335 - 7113391
Alignment:
| Q |
195 |
aaatttagggggtgtattggatca---tgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
7113335 |
aaattaagggggtgtattggatcatcatgattctaagggattttaaaagactttttt |
7113391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 12893297 - 12893343
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
12893297 |
gggggtgtattggatcatgattctaaggtattttaaaagattttttt |
12893343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 47879059 - 47879105
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
47879059 |
gggtgtattgaatcatgattctaagggattttaaaagacttatttat |
47879105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 47914157 - 47914203
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
47914157 |
gggtgtattgaatcatgattctaagggattttaaaagacttatttat |
47914203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 43679363 - 43679404
Alignment:
| Q |
207 |
tgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
43679363 |
tgtattggatcatgattctaagggattttaaaagattttttt |
43679404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 7993023 - 7993069
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||| |||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
7993023 |
aggggatgtattggattaagattctataggattttaaaagacttttt |
7993069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 247
Target Start/End: Complemental strand, 9882549 - 9882509
Alignment:
| Q |
207 |
tgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
9882549 |
tgtattggattaggattctataggattttaaaagacttttt |
9882509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 247
Target Start/End: Complemental strand, 29615085 - 29615037
Alignment:
| Q |
199 |
ttagggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
29615085 |
ttaggggatgtattggattatgattctatgagattttaaaagacttttt |
29615037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 21)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 9120049 - 9120106
Alignment:
| Q |
194 |
gaaatttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9120049 |
gaaattaagggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
9120106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 31170947 - 31170896
Alignment:
| Q |
200 |
tagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31170947 |
tagggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
31170896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 198 - 251
Target Start/End: Complemental strand, 22552088 - 22552035
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22552088 |
tttagtgggtgtattggatcatgattctaagggattttaaaagacttttttatc |
22552035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 24776244 - 24776293
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24776244 |
gggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
24776293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 26601522 - 26601473
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26601522 |
agggggtgtattggatcatgtttctaaaggattttaaaagacttttttat |
26601473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 16269581 - 16269628
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16269581 |
ggggtgtattggatcatgattctaagggattttaaaagacttttttat |
16269628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 198 - 248
Target Start/End: Complemental strand, 305792 - 305742
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
305792 |
tttagggggtgtattggatcatgattctaagcgattttaaaagactttttt |
305742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 12407268 - 12407318
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12407268 |
agggggtgtattggatcatgattctaagagattttaaaagacttttttatc |
12407318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 14198894 - 14198848
Alignment:
| Q |
205 |
ggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14198894 |
ggtgtattggatcatgattctaagggattttaaaagacttttttatc |
14198848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 205 - 251
Target Start/End: Original strand, 44765667 - 44765713
Alignment:
| Q |
205 |
ggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44765667 |
ggtgtattggatcatgattctaagggattttaaaagacttttttatc |
44765713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 203 - 247
Target Start/End: Original strand, 20605042 - 20605086
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20605042 |
ggggtgtattggatcatgattctaagggattttaaaagacttttt |
20605086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 1789331 - 1789380
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
1789331 |
gggggtgtattggatcatgattctaagagattttaaaagatttttttatc |
1789380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 35316947 - 35317000
Alignment:
| Q |
198 |
tttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
35316947 |
tttaaggggtgtattgaatcatgattctaagggattttaaaaaacttttttatc |
35317000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 250
Target Start/End: Complemental strand, 14920666 - 14920619
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
14920666 |
ggggtgtattggattgtgattttaaaggattttaaaagacttttttat |
14920619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 378868 - 378913
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
378868 |
ggggatgtattggatcatgattataagggattttaaaagacttttt |
378913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 251
Target Start/End: Original strand, 43847536 - 43847584
Alignment:
| Q |
203 |
ggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
43847536 |
ggggtgtattagatcatgtatctaagggattttaaaagacttttttatc |
43847584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 243
Target Start/End: Complemental strand, 5093352 - 5093317
Alignment:
| Q |
208 |
gtattggatcatgattctaaaggattttaaaagact |
243 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5093352 |
gtattggatcatgattctaagggattttaaaagact |
5093317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 19144912 - 19144962
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| | ||||||||| |
|
|
| T |
19144912 |
agggggtgtattggaatatgattctaagggattttaaaatatttttttatc |
19144962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 247
Target Start/End: Original strand, 28844439 - 28844489
Alignment:
| Q |
197 |
atttagggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||||| |||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
28844439 |
atttaggggatgtattggattaggattctatgggattttaaaagacttttt |
28844489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 33135512 - 33135557
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
|||| |||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
33135512 |
ggggatgtattggattaggattctataggattttaaaagacttttt |
33135557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 41725968 - 41725924
Alignment:
| Q |
23 |
tttgatttttgtgaattgacaaatacattcatgaaattgtaaaat |
67 |
Q |
| |
|
|||||||||||||||||||||| || ||| |||||||||||||| |
|
|
| T |
41725968 |
tttgatttttgtgaattgacaagtatatttgtgaaattgtaaaat |
41725924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 39178 - 39123
Alignment:
| Q |
196 |
aatttagggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39178 |
aattaagggggtgtattggatcatgattctaatggattttaaaagacttttttatc |
39123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 100098 - 100148
Alignment:
| Q |
201 |
agggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
100098 |
agggggtgtattggatcatgattctaagggattttaaaagacttttttatc |
100148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 102026 - 102072
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttat |
250 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
102026 |
gggtgtattagatcatgattctaagggattttaaaagacttttttat |
102072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0651 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0651
Description:
Target: scaffold0651; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8654 - 8699
Alignment:
| Q |
206 |
gtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
8654 |
gtgtattggatcatgattctaagggattttaaaagatttttttatc |
8699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0151 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0151
Description:
Target: scaffold0151; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 38837 - 38790
Alignment:
| Q |
204 |
gggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
38837 |
gggtgtattggatcatgattctaagggattttaaaagatatttttatc |
38790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0400 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 15349 - 15303
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
15349 |
gggggtgtattggatcatgattctaaggg---ttaaaagacttttttatc |
15303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 15992 - 15946
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagacttttttatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
15992 |
gggggtgtattggatcatgattctaaggg---ttaaaagacttttttatc |
15946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 198 - 247
Target Start/End: Original strand, 4083 - 4133
Alignment:
| Q |
198 |
tttaggggg-tgtattggatcatgattctaaaggattttaaaagacttttt |
247 |
Q |
| |
|
||||||||| |||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
4083 |
tttagggggatgtattggattaggattctataggattttaaaagacttttt |
4133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 81868 - 81822
Alignment:
| Q |
202 |
gggggtgtattggatcatgattctaaaggattttaaaagactttttt |
248 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
81868 |
gggggtgtattggattgagattttaaaggattttaaaagactttttt |
81822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University