View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7720_low_15 (Length: 210)
Name: NF7720_low_15
Description: NF7720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7720_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 10 - 194
Target Start/End: Complemental strand, 1697134 - 1696951
Alignment:
| Q |
10 |
atcaaaatcatcccagctctaaaaactccaaaatttaagtaaatcaaaatcaatcacacacgcttatctcatgccaannnnnnnnatttggatgagctta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1697134 |
atcaaaatcatcccagctctaaaaactccaaaatttaagtaaatcaaaatc-atcacacacgcttatctcatgccatttttttttatttggatgggctta |
1697036 |
T |
|
| Q |
110 |
aataataacaacaataatattggatgttctccattcaagtcgactcgtccatgacttaacagctgttcgatagagatcatactat |
194 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||| |||||||| |||||| |||| || || ||||||||||| ||||| |
|
|
| T |
1697035 |
aataataacaacaataatattggattttcttcattcaagttgactcgtcgatgactaaacaactattagatagagatcagactat |
1696951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 127
Target Start/End: Complemental strand, 1686831 - 1686766
Alignment:
| Q |
62 |
atcacacacgcttatctcatgccaannnnnnnnatttggatgagcttaaataataacaacaataat |
127 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
1686831 |
atcacacacgcctatctcatgccaaaaatttaaatttggatgagcttaaataacaacaacaataat |
1686766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University