View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_high_100 (Length: 218)
Name: NF7721_high_100
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_high_100 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 54 - 199
Target Start/End: Original strand, 11835717 - 11835867
Alignment:
| Q |
54 |
tggttttgattttgtcatgtttgtgtaactgtgatgaaaaatagtgaaggatttgtgcggttttatagagaaggattgaggcatgagggcactgtgtta- |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11835717 |
tggttttgattttgtcatgtttgtgtaactgtgatgaaaaatagtgaaggatttgtgcggttttatagagaaggattgaggcatgagggcactgtgttat |
11835816 |
T |
|
| Q |
153 |
----ttgggagttatggttcaaatatctgttgtatatggggccatgcagac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11835817 |
tatcttgggagttatggttcaaatatctgttgtatatggggccatgcagac |
11835867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University