View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_high_59 (Length: 306)
Name: NF7721_high_59
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_high_59 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 70 - 118
Target Start/End: Original strand, 35737948 - 35737996
Alignment:
| Q |
70 |
tgtgatttcgaacatgcatagtatctgcactcagattagatcatcagat |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35737948 |
tgtgattccgaacatgcatagtatctgcactcagattagatcatcagat |
35737996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 35740776 - 35740841
Alignment:
| Q |
1 |
tcaattgcatatttggatttgcggtgaatttgtgaaaatcacaacaccatgagtttgtcaaaccta |
66 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
35740776 |
tcaattgcatatttagatttgcggaggatttgtgaaaatcatagcaccatgattttgtcaaaccta |
35740841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 255 - 306
Target Start/End: Original strand, 36134561 - 36134612
Alignment:
| Q |
255 |
ggagactgatatcttgccattaattgccaataatattgtgaagatactgtca |
306 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
36134561 |
ggagattgatatcttgccattaattgccaataacatcatgaagatattgtca |
36134612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University