View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7721_high_78 (Length: 255)

Name: NF7721_high_78
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7721_high_78
NF7721_high_78
[»] chr5 (1 HSPs)
chr5 (14-116)||(5137054-5137156)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 116
Target Start/End: Original strand, 5137054 - 5137156
Alignment:
14 tggtgttccaatgatttcatttatttatttcataatatattatgtctaaccaatctaaattgataatttatagcggataacttattacgtattagtttat 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||  ||||||    
5137054 tggtgttccaatgatttcatttatttatttcataatatattatgtctaaccaatctaaattgataatttatagcggataatttattgcgtatatgtttat 5137153  T
114 tta 116  Q
    |||    
5137154 tta 5137156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University