View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_high_79 (Length: 254)
Name: NF7721_high_79
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_high_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 42495891 - 42495672
Alignment:
| Q |
17 |
agatctgagatggaagtgttaatgcagtatataagttttagttttcgctctcattannnnnnnatggtatgattgatcggtttgttatgtctattgacag |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42495891 |
agatctgagatggaagtgttaatgtagtatataagttttagttttcgctctcattatttttttatggtatgattgatcggtttgttatgtctattgacag |
42495792 |
T |
 |
| Q |
117 |
gaaactctgctggagtttcgtgctggtaaaatgtcactagagggaaaaagggtagttcctgatgcacgcaaaggactcgttcgtattgctagggtatgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42495791 |
gaaactctgctggagtttcgtgctggtaaaatgtcactagagggaaaaagggtagttcctgatgcacgcaaaggactcgttcgtattgctagggtatgct |
42495692 |
T |
 |
| Q |
217 |
tcgcttcaatattagtttcg |
236 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
42495691 |
ttgcttcaatattagtttcg |
42495672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University