View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_high_86 (Length: 242)
Name: NF7721_high_86
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_high_86 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 32863581 - 32863356
Alignment:
| Q |
1 |
ttaaacatagtggttaaaaatatcaaatttattttggtgtcaaaacgtgnnnnnnngtacgtgaccacaaattgattatacaaaatatatcaatctttct |
100 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32863581 |
ttaaacatagtggttataaatattaaatttattttggtgtcaaaacgtgtttttttgtacgtgaccacaaattgattatacaaaatatatcaatctttct |
32863482 |
T |
|
| Q |
101 |
tttaacaaaattgatatattttgtgtaaatatatcaatttttcaaagataaatagtcacgtaccctgcaaattttgttaacatcaattttcggttacaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32863481 |
tttaacaaaattgatatattttgtgtaaatatatcaatttttcaaagataaatagtcacgtaccctgcaaattttgttaacatcaattttcagttacaaa |
32863382 |
T |
|
| Q |
201 |
tctgattcaacaggggacgaacaaga |
226 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
32863381 |
tctgattcagcaggggacgaacaaga |
32863356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University