View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_101 (Length: 255)
Name: NF7721_low_101
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_101 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 116
Target Start/End: Original strand, 5137054 - 5137156
Alignment:
| Q |
14 |
tggtgttccaatgatttcatttatttatttcataatatattatgtctaaccaatctaaattgataatttatagcggataacttattacgtattagtttat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
5137054 |
tggtgttccaatgatttcatttatttatttcataatatattatgtctaaccaatctaaattgataatttatagcggataatttattgcgtatatgtttat |
5137153 |
T |
|
| Q |
114 |
tta |
116 |
Q |
| |
|
||| |
|
|
| T |
5137154 |
tta |
5137156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University