View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_106 (Length: 249)
Name: NF7721_low_106
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 43 - 233
Target Start/End: Original strand, 6329890 - 6330080
Alignment:
| Q |
43 |
gaagatctgttgaatgactcaacatcctaatatatggtgctaaacataactcgttggcttactgttatagagctaactggacaccttagaaactaaactc |
142 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6329890 |
gaagatctgttgaatgactcgacatcctaatatctggtgctaaacagaactagttggcttactgttatagagctaactgaacaccttagaaactaaactc |
6329989 |
T |
 |
| Q |
143 |
agaaaaatataaatagagaactgaacaacaaattgtattgggtctcaaacatgaaaataatcatgtttataattttggtgactgttcattt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6329990 |
agaaaaatataaatagagaactgaacaacaaattgtattgggtctcaaacatgaaaataatcatgtttataattttggtgactgttcattt |
6330080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University