View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_112 (Length: 241)
Name: NF7721_low_112
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_112 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 32557414 - 32557192
Alignment:
| Q |
1 |
gcaggttctgtgaatggtacttttgattttgggagctcttcatttttcttctgagataaattatgtactctttcattttcatggttgagagaatttatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557414 |
gcaggttctgtgaatggtacttttgattttgggagctcttcatttttcttctgagataaattatgtactctttcattttcatggttgagagaatttatat |
32557315 |
T |
 |
| Q |
101 |
gnnnnnnnnngtgtgagattgtctgtatttttgttttcatttgtcatgtcgtggaatgtgtaaactgtttatggacatatttcgcgaatatatggggaaa |
200 |
Q |
| |
|
| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32557314 |
gttttttt--gtgtgagagtgtctgtatttttgttttcatttgtcatgtcgtggaatgtgtaaactgtttgtggacatatttcgcgaatatatggggaaa |
32557217 |
T |
 |
| Q |
201 |
ttgtcttacgttagaggcatgagat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32557216 |
ttgtcttacgttagaggcatgagat |
32557192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University